Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU089521

Sigma-Aldrich

MISSION® esiRNA

targeting human ATM

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ATM(472) , ATM(472)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yichong Zhang et al.
Science signaling, 11(538) (2018-07-12)
Mitochondria are integral to cellular energy metabolism and ATP production and are involved in regulating many cellular processes. Mitochondria produce reactive oxygen species (ROS), which not only can damage cellular components but also participate in signal transduction. The kinase ATM
Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Hongbo Chen et al.
Oncotarget, 7(50), 83241-83257 (2016-11-10)
PICT-1 is an essential ribosome biogenesis factor whose loss induces p53 accumulation and apoptosis. Here, we show that DNA damage changes PICT-1 localization and decreases PICT-1 protein levels via the proteasome pathway. Two important phosphatidylinositol 3-kinase-like kinases (PIKKs), ataxia-telangiectasia mutated
Mingjing Shen et al.
Journal of experimental & clinical cancer research : CR, 38(1), 149-149 (2019-04-10)
The cisplatin-resistance is still a main course for chemotherapy failure of lung cancer patients. Cisplatin-resistant cancer cells own higher malignance and exhibited increased metastatic ability, but the mechanism is not clear. In this study, we investigated the effects of Ataxia

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.