Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU087831

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM29

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCATGGATGCTCTGGATGAGAGAGCCAAGGTGCTGCATGAGGACAAGCAGACCCGGGAGCAGCTGCATAGCATCAGCGACTCTGTGTTGTTTCTGCAGGAATTTGGTGCATTGATGAGCAATTACTCTCTCCCCCCACCCCTGCCCACCTATCATGTCCTGCTGGAGGGGGAGGGCCTGGGACAGTCACTAGGCAACTTCAAGGACGACCTGCTCAATGTATGCATGCGCCACGTTGAGAAGATGTGCAAGGCGGACCTGAGCCGTAACTTCATTGAGAGGAACCACATGGAGAACGGTGGTGACCATCGCTATGTGAACAACTACACGAACAGCTTCGGGGGTGAGTGGAGTGCACCGGACACCATGAAGAGATACTCCATGTACCTGACACCCAAAGGTGGGGTCCGGACATCATACCAGCCCTCGTC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jing Han et al.
Aging, 13(4), 5034-5054 (2021-01-27)
Targeted molecular therapy is the most effective treatment for cancer. An effective therapeutic target for colorectal cancer (CRC) is urgently needed. However, the mechanisms of CRC remain poorly understood, which has hampered research and development of CRC-targeted therapy. TRIM29 is
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Yasushi Masuda et al.
Nature communications, 6, 7299-7299 (2015-06-23)
Although DNA double-strand break (DSB) repair is mediated by numerous proteins accumulated at DSB sites, how DNA repair proteins are assembled into damaged chromatin has not been fully elucidated. Here we show that a member of the tripartite motif protein

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.