Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU085701

Sigma-Aldrich

MISSION® esiRNA

targeting human APP

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAGAACCACCAGCA

N° accesso Ensembl | uomo

ENSG00000142192

N° accesso NCBI

NM_201414

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... APP(351) , APP(351)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
MQU
QPU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bruce X Wong et al.
PloS one, 9(12), e114174-e114174 (2014-12-03)
Ceruloplasmin is a ferroxidase that interacts with ferroportin to export cellular iron, but is not expressed in neurons. We recently reported that the amyloid precursor protein (APP) is the analogous iron-exporting chaperone for neurons and other cells. The ferroxidase activity
Nathalie Pierrot et al.
EMBO molecular medicine, 5(4), 608-625 (2013-04-05)
Perturbation of lipid metabolism favours progression of Alzheimer disease, in which processing of Amyloid Precursor Protein (APP) has important implications. APP cleavage is tightly regulated by cholesterol and APP fragments regulate lipid homeostasis. Here, we investigated whether up or down
Livius V d'Uscio et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 38(10), 1715-1726 (2017-09-30)
The exact physiological function of amyloid-β precursor protein (APP) in endothelial cells is unknown. Endothelium-specific APP-deficient (eAPP-/-) mice were created to gain new insights into the role of APP in the control of vascular endothelial function. Endothelium-dependent relaxations to acetylcholine
Changyi Ji et al.
Cellular and molecular neurobiology, 38(4), 941-954 (2017-11-28)
Iron efflux in mammalian cells is mediated by the ferrous iron exporter ferroportin (Fpn); Fpn plasma membrane localization and function are supported by a multicopper ferroxidase and/or the soluble amyloid precursor protein (sAPP). Fpn and APP are ubiquitously expressed in
Shao Li et al.
Scientific reports, 6, 39320-39320 (2016-12-23)
Amyloid precursor protein (APP), commonly associated with Alzheimer's disease, also marks axonal degeneration. In the recent studies, we demonstrated that APP aggregated at nodes of Ranvier (NORs) in myelinated central nervous system (CNS) axons and interacted with Nav1.6. However, the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.