Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU084671

Sigma-Aldrich

MISSION® esiRNA

targeting human COPS5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCACTGAAACCCGAGTAAATGCTCAGGCTGCTGCATATGAATACATGGCTGCATACATAGAAAATGCAAAACAGGTTGGCCGCCTTGAAAATGCAATCGGGTGGTATCATAGCCACCCTGGCTATGGCTGCTGGCTTTCTGGGATTGATGTTAGTACTCAGATGCTCAATCAGCAGTTCCAGGAACCATTTGTAGCAGTGGTGATTGATCCAACAAGAACAATATCCGCAGGGAAAGTGAATCTTGGCGCCTTTAGGACATACCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATTCCACTTAATAAAATAGAAGATTTTGGTGTACACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCCTCTTTGGATCGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

S Wang et al.
Oncogene, 35(47), 6096-6108 (2016-05-10)
Radiotherapy is the standard therapy for nasopharyngeal carcinoma (NPC); however, radioresistance can hinder successful treatment. Here we report that microRNA (miR)-24 acts as a tumor suppressor and radiosensitizer in NPC cells and xenografts by targeting Jab1/CSN5. Although accumulating evidence has
Yang Liu et al.
Acta pharmaceutica Sinica. B, 10(12), 2299-2312 (2020-12-24)
Programmed cell death-1 (PD-1)/programmed cell death ligand-1 (PD-L1) blocking therapy has become a major pillar of cancer immunotherapy. Compared with antibodies targeting, small-molecule checkpoint inhibitors which have favorable pharmacokinetics are urgently needed. Here we identified berberine (BBR), a proven anti-inflammation
Anja Schwarz et al.
Journal of biomedical science, 24(1), 12-12 (2017-02-09)
Oxidized low-density lipoprotein (oxLDL) mediates the transformation of macrophages (MΦ) to cholesterol-rich foam cells and the release of pro-inflammatory cytokines during atherogenesis. JAB1 (Jun activation domain binding protein-1) is present in all stages of human plaques, involved in the Toll-like
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Michal Meir et al.
Nucleic acids research, 43(9), 4517-4530 (2015-04-10)
The DNA damage response is vigorously activated by DNA double-strand breaks (DSBs). The chief mobilizer of the DSB response is the ATM protein kinase. We discovered that the COP9 signalosome (CSN) is a crucial player in the DSB response and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.