Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU082281

Sigma-Aldrich

MISSION® esiRNA

targeting human TEK

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAATTTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGAAGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTGCTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAGGCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCTCAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACAATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAATGAAGACCAGCACGTTGATGTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Adam C Mirando et al.
JCI insight, 4(4) (2019-01-23)
The angiopoietin (Ang)/Tie2 signaling pathway is essential for maintaining vascular homeostasis, and its dysregulation is associated with several diseases. Interactions between Tie2 and α5β1 integrin have emerged as part of this control; however, the mechanism is incompletely understood. AXT107, a
Kaihong Zeng et al.
Molecular and cellular biochemistry, 396(1-2), 239-248 (2014-07-26)
Previously, we confirmed that taurine prevented diabetes-induced apoptosis in retinal glial cells via its anti-oxidation and anti-glutamate excitotoxicity mechanisms. The aim of this study is to investigate the effects of taurine on angiopoietin-2 (Ang-2)/Tie-2 system expressions and apoptosis in high
Martin Teichert et al.
Nature communications, 8, 16106-16106 (2017-07-19)
The Tie receptors with their Angiopoietin ligands act as regulators of angiogenesis and vessel maturation. Tie2 exerts its functions through its supposed endothelial-specific expression. Yet, Tie2 is also expressed at lower levels by pericytes and it has not been unravelled

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.