Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU079251

Sigma-Aldrich

MISSION® esiRNA

targeting human AIFM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAAAAGCAACTGCACAAGACAACCCCAAATCTGCCACAGAGCAGTCAGGAACTGGTATCCGATCAGAGAGTGAGACAGAGTCCGAGGCCTCAGAAATTACTATTCCTCCCAGCACCCCGGCAGTTCCACAGGCTCCCGTCCAGGGGGAGGACTACGGCAAAGGTGTCATCTTCTACCTCAGGGACAAAGTGGTCGTGGGGATTGTGCTATGGAACATCTTTAACCGAATGCCAATAGCAAGGAAGATCATTAAGGACGGTGAGCAGCATGAAGATCTCAATGAAGTAGCCAAACTATTCAACATTCATGAAGACTGAAGCCCCACAGTGGAATTGGCAAACCCACTGCAGCCCCTGAGAGGAGGTCGAATGGGTAAAGGAGCATTTTTTTATTCAGCAGACTTTCTCTGTGTATGAGTGTGAATGATCAAGTCCTTTGTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mausumi Basu et al.
PLoS pathogens, 13(2), e1006240-e1006240 (2017-02-28)
Oxidative stress activates the cellular kinase HRI, which then phosphorylates eIF2α, resulting in stalled translation initiation and the formation of stress granules (SGs). SG assembly redirects cellular translation to stress response mRNAs and inhibits cap-dependent viral RNA translation. Flavivirus infections
Hongwei Zhao et al.
Cancer letters, 374(1), 136-148 (2016-02-09)
Programmed necrosis is established as a new form of programmed cell death and is emerging as a new strategy of treatment for cancers. Pristimerin is a natural chemical with anti-tumor effect despite the fact that its mechanism remains poorly understood.
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Nan Zhao et al.
Oncotarget, 6(21), 18445-18459 (2015-06-20)
Here we demonstrated that sepantronium bromide (YM155), a survivin suppressant, inhibited esophageal squamous-cell carcinoma (ESCC) growth in mice bearing human ESCC xenografts without affecting body weight. In cell culture, YM155 decreased survivin levels and caused PARP-1 activation, poly-ADP polymer formation

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.