Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU076701

Sigma-Aldrich

MISSION® esiRNA

targeting human TAZ

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCTGGGAGATAGGCCTTGCTTGCTGCCTTCTGGATTCTTGGCCCGCACAGAGCTGGGGCTGAGGGATGGACTGATGCTTTTAGCTCAAACGTGGCTTTTAGACAGATTTGTTCATAGACCCTCTCAAGTGCCCTCTCCGAGCTGGTAGGCATTCCAGCTCCTCCGTGCTTCCTCAGTTACACAAAGGACCTCAGCTGCTTCTCCCACTTGGCCAAGCAGGGAGGAAGAAGCTTAGGCAGGGCTCTCTTTCCTTCTTGCCTTCAGATGTTCTCTCCCAGGGGCTGGCTTCAGGAGGGAGCATAGA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenguang Chang et al.
Molecular nutrition & food research, 63(7), e1801322-e1801322 (2019-01-12)
High fat (HF)-diet-induced insulin resistance is a major contributor to the pathogenesis of cardiovascular diseases. However, the molecular mechanisms that regulate cardiac insulin signaling are not fully understood. The regulatory role of tafazzin in the hearts of HF-diet-fed mice is
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.