Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU075891

Sigma-Aldrich

MISSION® esiRNA

targeting human SOD2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCA

N° accesso Ensembl | uomo

ENSG00000112096

N° accesso NCBI

NM_000636

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SOD2(6648) , SOD2(6648)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
YIU
QCS
HUT
QQT
ZAS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Miyoung Lee et al.
Antioxidants (Basel, Switzerland), 9(1) (2020-01-17)
Umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) are accessible, available in abundance, and have been shown to be a promising source that can regenerate cartilage in patients with osteoarthritis or other orthopedic diseases. Recently, a three-dimensional (3D) cell culture system
Brianna M Young et al.
Molecular therapy. Methods & clinical development, 14, 113-125 (2019-07-25)
Age-related macular degeneration (AMD) has been linked to oxidative damage and para-inflammation, an activation of inflammasome signaling in the retinal pigment epithelium (RPE) and the underlying choriocapillaris. Herein, we tested the efficacy of a gene-delivered caspase-1 inhibitor in controlling the
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
You Dong Liu et al.
International journal of cancer, 144(12), 3056-3069 (2018-12-12)
Toll-like receptors (TLRs) play critical roles in host defense after recognition of conserved microbial- and host-derived components, and their dysregulation is a common feature of various inflammation-associated cancers, including gastric cancer (GC). Despite the recent recognition that metabolic reprogramming is
Serena Sagliocchi et al.
Redox biology, 24, 101228-101228 (2019-06-04)
Thyroid hormone (TH) is a key metabolic regulator that acts by coordinating short- and long-term energy needs. Accordingly, significant metabolic changes are observed depending on thyroid status. Although it is established that hyperthyroidism augments basal energy consumption, thus resulting in
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.