Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU073901

Sigma-Aldrich

MISSION® esiRNA

targeting human AXIN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTTCTGGTTTGCCTGCACTGGCTTCAGGAAGCTGGAGCCCTGTGACTCGAACGAGGAGAAGAGGCTGAAGCTGGCGAGAGCCATCTACCGAAAGTACATTCTTGATAACAATGGCATCGTGTCCCGGCAGACCAAGCCAGCCACCAAGAGCTTCATAAAGGGCTGCATCATGAAGCAGCTGATCGATCCTGCCATGTTTGACCAGGCCCAGACCGAAATCCAGGCCACTATGGAGGAAAACACCTATCCCTCCTTCCTTAAGTCTGATATTTATTTGGAATATACGAGGACAGGCTCGGAGAGCCCCAAAGTCTGTAGTGACCAGAGCTCTGGGTCAGGGACAGGGAAGGGCATATCTGGATACCTGCCGACCTTAAATGAAGATGAGGAATGGAAGTGTGACCAGG

N° accesso Ensembl | uomo

ENSG00000103126

N° accesso NCBI

NM_181050

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... AXIN1(8312) , AXIN1(8312)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yu Chen et al.
PloS one, 10(7), e0133115-e0133115 (2015-07-24)
During development, scaffold proteins serve as important platforms for orchestrating signaling complexes to transduce extracellular stimuli into intracellular responses that regulate dendritic spine morphology and function. Axin ("axis inhibitor") is a key scaffold protein in canonical Wnt signaling that interacts
Yongjuan Zhang et al.
Biochemical and biophysical research communications, 513(1), 261-268 (2019-04-08)
Caveolin-1 has been reported to play an important role in the pathogenesis of acute respiratory distress syndrome (ARDS). This study was designed to identify Caveolin-1-interacting proteins to reveal the molecular mechanisms of ARDS. Yeast two-hybrid screening was performed using Caveolin-1
Shiwei Zhou et al.
Pharmaceutics, 13(3) (2021-04-04)
Genetic evidence has indicated that β-catenin plays a vital role in glucose and lipid metabolism. Here, we investigated whether pyrvinium, an anthelmintic agent previously reported as a down-regulator of cellular β-catenin levels, conferred any metabolic advantages in treatment of metabolic
Dongshao Chen et al.
Cancer management and research, 11, 1349-1362 (2019-02-28)
Characterized by elevated AFP levels in serum, AFP-producing gastric cancer (APGC) is a very special type of gastric cancer (GC) that is difficult to treat and has poor prognosis. However, little is known about the role of AFP in GC
Hae-Kyung Lee et al.
Oncogene, 37(31), 4273-4286 (2018-05-02)
The adenomatous polyposis coli (APC) protein has a tumor-suppressor function by acting as a negative regulator of the Wnt signaling pathway. While its role as a tumor suppressor is well-defined, the post-translational modifications that regulate APC stability are not fully

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.