Passa al contenuto
Merck
Tutte le immagini(2)

Documenti fondamentali

EHU070511

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCTCCTTCCCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Smruthi Vijayaraghavan et al.
Nature communications, 8, 15916-15916 (2017-06-28)
Deregulation of the cell cycle machinery is a hallmark of cancer. While CDK4/6 inhibitors are FDA approved (palbociclib) for treating advanced estrogen receptor-positive breast cancer, two major clinical challenges remain: (i) adverse events leading to therapy discontinuation and (ii) lack
Amriti R Lulla et al.
Cancer research, 77(24), 6902-6913 (2017-10-25)
CDK4/6 targeting is a promising therapeutic strategy under development for various tumor types. In this study, we used computational methods and The Cancer Genome Atlas dataset analysis to identify novel miRNAs that target CDK4/6 and exhibit potential for therapeutic development
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Guoyan Liu et al.
The Journal of pathology, 233(3), 308-318 (2014-03-08)
Ovarian carcinoma is the most lethal gynaecological malignancy. Better understanding of the molecular pathogenesis of this disease and effective targeted therapies are needed to improve patient outcomes. MicroRNAs play important roles in cancer progression and have the potential for use

Articoli

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.