Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU069501

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD2 (2)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAAT

N° accesso Ensembl | uomo

ENSG00000175387

N° accesso NCBI

NM_005901

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SMAD2(4087) , SMAD2(4087)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ping Zhao et al.
Cancer chemotherapy and pharmacology, 84(2), 427-439 (2019-05-16)
Although DNA-mismatch-repair-deficient (dMMR) status and aberrant expression of miRNAs are both critically implicated in the pathogenesis of resistance to 5-fluorouracil (5-FU) in colorectal cancer (CRC), whether these two factors regulate tumor response to 5-FU in a coordinated manner remains unknown.
Qingde Wa et al.
Oncology reports, 39(1), 81-90 (2017-11-16)
Constitutive activation of TGF‑β signaling pathway is a well-documented mechanism responsible for the bone metastasis of prostate cancer (PCa). MicroRNAs (miRNAs) have been reported to be crucial for the activation of TGF‑β signaling via targeting downstream components of TGF‑β signaling
Wei Zhang et al.
Journal of Cancer, 12(6), 1678-1686 (2021-02-23)
Circular RNAs (circRNAs) are associated with various diseases, including cancers. However, their roles in colorectal cancer (CRC) have not been established. Hsa_circ_0000847 (circ_SMAD2) is a novel circRNA that was found to be elevated in CRC cell lines and tissues. High
Benjamin V Park et al.
Cancer discovery, 6(12), 1366-1381 (2016-09-30)
Programmed death-1 (PD-1) is a coinhibitory receptor that downregulates the activity of tumor-infiltrating lymphocytes (TIL) in cancer and of virus-specific T cells in chronic infection. The molecular mechanisms driving high PD-1 expression on TILs have not been fully investigated. We
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.