Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU068241

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGGCTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGCAGGGAAATTTGACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCGACCGTGCTGTGTGACATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATATAAATATGTGGAAGATTACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGAGGCCTACCCCACACCTGGGCTCTCCACAGCCCCATCAAAGAACAGAGAGGAGGAGGAGGGAGAAATGGCCACCACATCACCCCAGAGAAATTTCTGGAATCTGATTGAGTCTCCACTCCACAAGCACTCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jun-Feng Huo et al.
Journal of cellular biochemistry, 120(4), 6322-6329 (2018-10-27)
Purinergic receptor P2X 4 (P2X4R), a member of purinergic channels family and a subtype of ionotropic adenosine triphosphate receptors, plays a critical role in tumorigenesis. Evidence suggested that P2X4R is expressed in rat C6 glioma model, however, its role and
Dmitry Aminin et al.
Scientific reports, 6, 39683-39683 (2016-12-23)
Since ancient times, edible sea cucumbers have been considered a jewel of the seabed and used in Asian folk medicine for stimulation of resistance against different diseases. However, the power of this sea food has not been established on a
Larisa Gofman et al.
Alcohol and alcoholism (Oxford, Oxfordshire), 51(6), 647-654 (2016-10-30)
Previously we have demonstrated altered microglia P2X4R expression in response to alcohol and pharmacological blockade with a selective P2X4R antagonist can reverse the action, suggesting that P2X4R play a role in mediating alcohol-induced effects on microglia. In the present study
Xiao-Hong Jin et al.
Journal of neuroscience research, 92(12), 1690-1702 (2014-07-06)
Previous studies have suggested that the microglial P2X7 purinoceptor is involved in the release of tumor necrosis factor-α (TNFα) following activation of toll-like receptor-4 (TLR4), which is associated with nociceptive behavior. In addition, this progress is evoked by the activation

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.