Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU064421

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATGGTCCCCTTCCTCTACCATACAGGCACTATATTGCAATAATGGCTGCAGCTAGACATCAGTGTTCTTACTTAATAAACATGCATGTGGATGAATTTTTAAAGACTGGAGGTATTGCTGAGTGGTTGAATGGTTTGGAATATGTGCCACAAAGACTGAAAAATCTTAATGAAATTAATAAGCTGCTAGCACATCGACCTTGGCTGATCACAAAAGAGCACATTCAGAAACTTGTCAAAACTGGAGAAAATAATTGGTCTCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTTGGTAGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAATTTCTGCGTTTGTGATCTTGC

N° accesso Ensembl | uomo

ENSG00000149212

N° accesso NCBI

NM_144665

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SESN3(143686) , SESN3(143686)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yasuo Miki et al.
Neuroscience letters, 684, 35-41 (2018-07-04)
Neurodegenerative disorders such as Parkinson's disease (PD) and dementia with Lewy bodies (DLB) are characterized by impairment of autophagy. Cellular survival is dependent on efficient clearance of phosphorylated α-synuclein, which accumulates as fibrils in the neuronal cytoplasm as Lewy bodies
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.