Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU061431

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10B

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yongqing Liu et al.
Oncology letters, 15(3), 2871-2880 (2018-02-13)
Retigeric acid B (RAB), a natural compound isolated from lichen, has been demonstrated to inhibit cell growth and promote apoptosis in prostate cancer (PCa) cells. The present study evaluated the function of RAB combined with clinical chemotherapeutic drugs in PCa
Cheng-Hung Chuang et al.
Chemico-biological interactions, 306, 54-61 (2019-04-09)
In the present study, we investigated the p53-independent mechanism by which quercetin (Q) increased apoptosis in human lung cancer H1299 cells exposed to trichostatin A (TSA), a histone deacetylase inhibitor. We also investigated the role of Q in increasing the acetylation
Mi Hee Park et al.
Biochemical and biophysical research communications, 473(2), 586-592 (2016-04-02)
We investigated whether bakuchiol, an analog of resveratrol enhances the apoptosis ability of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in cancer cells. Bakuchiol enhanced expression of cell death receptor (DR) in TRAIL-sensitive and -resistant colon cancer cells in a
Fanyun Kong et al.
Virology journal, 12, 192-192 (2015-11-19)
HBV X protein (HBX) is associated with cell apoptosis mediated by TNF-α related apoptosis inducing ligand (TRAIL), while the role of HBX on the expressions of TRAIL receptors death receptor 4 (DR4) and DR5 are unclear. In this study, we
Seon Min Woo et al.
International journal of molecular sciences, 20(13) (2019-07-05)
R428, a selective small molecule Axl inhibitor, is known to have anti-cancer effects, such as inhibition of invasion and proliferation and induction of cell death in cancer cells. The Axl receptor tyrosine kinase is highly expressed in cancer cells and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.