Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU058011

Sigma-Aldrich

MISSION® esiRNA

targeting human DPP4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TATCCAAAGGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCTCTCAGCTCAGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATAGGGGATCACTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGGCTCAGGAGGATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGAAGATGGAACTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGAAGATTTAGGCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATCAGCAATGAAGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACATTTATTACAAAAGGCACCTGGGAAG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Toshihiro Okamoto et al.
Biochemical and biophysical research communications, 504(2), 491-498 (2018-09-11)
Malignant pleural mesothelioma (MPM) is an aggressive malignancy arising from mesothelial lining of pleura. It is associated with a poor prognosis, partly due to the lack of a precise understanding of the molecular mechanisms associated with its malignant behavior. In
Ahmed A Al-Qahtani et al.
Oncotarget, 8(6), 9053-9066 (2017-01-25)
Middle East Respiratory Syndrome Corona Virus (MERS-CoV) is transmitted via the respiratory tract and causes severe Acute Respiratory Distress Syndrome by infecting lung epithelial cells and macrophages. Macrophages can readily recognize the virus and eliminate it. MERS-CoV infects cells via
Youichi Sato et al.
The Journal of endocrinology, 223(2), 133-142 (2014-08-15)
In a previous study, we demonstrated that dipeptidyl peptidase 4 (DPP4)-deficient rats were susceptible to reduced glomerular filtration rate as a result of streptozotocin (STZ)-induced diabetes. Therefore, we proposed that DPP4 might be responsible for the preservation of renal function.

Protocolli

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.