Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU056141

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGGGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGAAACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGACTTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGGAAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGGTGAATATAGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTGTCCTGCAAACTGCAAATAGTAGTTCCTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTTCGGCATACAAATAATACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGG

N° accesso Ensembl | uomo

ENSG00000149554

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CHEK1(1111) , CHEK1(1111)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ACIU
QWU
SVU
BBU
YHT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yan Liu et al.
Cancer research, 77(18), 5068-5076 (2017-07-30)
Cells lacking the tumor suppressor gene
Ming Bai et al.
Cell biology international, 42(7), 781-793 (2017-12-23)
The ATM and Rad3-related (ATR)/checkpoint kinase 1 (Chk1) pathway plays a pivotal role in DNA damage sensor and modulating homologous recombination. Recently, emerging evidence demonstrated that Chk1 phosphorylation was associated with chemotherapy and radiotherapy resistance. In this study, we explored
L M Sarmento et al.
Oncogene, 34(23), 2978-2990 (2014-08-19)
Checkpoint kinase 1 (CHK1) is a key component of the ATR (ataxia telangiectasia-mutated and Rad3-related)-dependent DNA damage response pathway that protect cells from replication stress, a cell intrinsic phenomenon enhanced by oncogenic transformation. Here, we show that CHK1 is overexpressed
Wei-Hsun Hsu et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 14(6), 1032-1045 (2019-02-17)
Platinum-based chemotherapy remains the standard treatment for patients with SCLC, but the benefit of the treatment is often hampered by rapid development of drug resistance. Thus far, there is no targeted therapy available for SCLC. More than 90% of SCLC
Lei Duan et al.
Oncogene, 38(28), 5643-5657 (2019-04-11)
Platinum-based drugs such as cisplatin (CP) are the first-line chemotherapy for non-small-cell lung carcinoma (NSCLC). Unfortunately, NSCLC has a low response rate to CP and acquired resistance always occurs. Histone methylation regulates chromatin structure and is implicated in DNA repair.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.