Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU054741

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKD1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kimberly A Coughlan et al.
The Journal of biological chemistry, 291(11), 5664-5675 (2016-01-23)
AMP-activated protein kinase (AMPK) is an energy-sensing enzyme whose activity is inhibited in settings of insulin resistance. Exposure to a high glucose concentration has recently been shown to increase phosphorylation of AMPK at Ser(485/491) of its α1/α2 subunit; however, the
Qi Zhou et al.
Archives of toxicology, 93(6), 1639-1648 (2019-04-26)
2,3',4,4',5-Pentachlorobiphenyl (PCB118) has been shown to cause thyroidal ultrastructure lesions, but the underlying mechanism remains elusive. This study aimed to elucidate the mechanism by which PCB118 induces the abnormalities of the thyrocytes. Wistar rats were injected intraperitoneally with PCB118 (0
Jonathan Baker et al.
PloS one, 13(4), e0195864-e0195864 (2018-04-14)
Many catabolic stimuli, including interleukin-1 (IL-1) in combination with oncostatin M (OSM), promote cartilage breakdown via the induction of collagen-degrading collagenases such as matrix metalloproteinase 1 (MMP1) and MMP13 in human articular chondrocytes. Indeed, joint diseases with an inflammatory component
Di Zhao et al.
International journal of biological sciences, 13(3), 276-285 (2017-04-04)
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively
Jia Wang et al.
American journal of physiology. Cell physiology, 310(7), C542-C557 (2016-01-08)
Given the fundamental role of β-catenin signaling in intestinal epithelial cell proliferation and the growth-promoting function of protein kinase D1 (PKD1) in these cells, we hypothesized that PKDs mediate cross talk with β-catenin signaling. The results presented here provide several

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.