Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU053371

Sigma-Aldrich

MISSION® esiRNA

targeting human SYP

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAGTACCCCTTCAGGCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTTAGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCTCTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAACAAAGGGCCCATGCTGGACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCCAAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCTGTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGA

N° accesso Ensembl | uomo

ENSG00000102003

N° accesso NCBI

NM_003179

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SYP(6855) , SYP(6855)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Teng-Fei Li et al.
Scientific reports, 7, 45056-45056 (2017-03-23)
Bulleyaconitine (BAA) has been shown to possess antinociceptive activities by stimulation of dynorphin A release from spinal microglia. This study investigated its underlying signal transduction mechanisms. The data showed that (1) BAA treatment induced phosphorylation of CREB (rather than NF-κB)
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke
Xiaochun Yang et al.
Oncotarget, 6(8), 6203-6217 (2015-03-10)
Liver dysfunction is a common side effect associated with the treatment of dasatinib and its mechanism is poorly understood. Autophagy has been thought to be a potent survival or death factor for liver dysfunction, which may shed the light on
Bruce C McGorum et al.
Molecular & cellular proteomics : MCP, 14(11), 3072-3086 (2015-09-15)
Equine grass sickness (EGS) is an acute, predominantly fatal, multiple system neuropathy of grazing horses with reported incidence rates of ∼2%. An apparently identical disease occurs in multiple species, including but not limited to cats, dogs, and rabbits. Although the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.