Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU050391

Sigma-Aldrich

MISSION® esiRNA

targeting human PIAS3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCGGACGGAATTACTCCTTGTCTGTGTACCTGGTGAGGCAGTTGACTGCAGGAACCCTTCTACAAAAACTCAGAGCAAAGGGTATCCGGAACCCAGACCACTCGCGGGCACTGATCAAGGAGAAATTGACTGCTGACCCTGACAGTGAGGTGGCCACTACAAGTCTCCGGGTGTCACTCATGTGCCCGCTAGGGAAGATGCGCCTGACTGTCCCTTGTCGTGCCCTCACCTGCGCCCACCTGCAGAGCTTCGATGCTGCCCTTTATCTACAGATGAATGAGAAGAAGCCTACATGGACATGTCCTGTGTGTGACAAGAAGGCTCCCTATGAATCTCTTATCATTGATGGTTTATTTATGGAGATTCTTAGTTCCTGTTCAGATTGTGATGAGATCCAATTCATGGAAGATGGATCCTGGTGCCCAATGAAACCCAAGAAGGAGGCATCTGAGG

N° accesso Ensembl | uomo

ENSG00000131788

N° accesso NCBI

NM_006099

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PIAS3(10401) , PIAS3(10401)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jeong-Hyeon Ko et al.
Immunopharmacology and immunotoxicology, 38(5), 334-343 (2016-06-22)
Constitutive activation of signal transducer and activator of transcription 3 (STAT3) is frequently observed and closely linked with proliferation, survival, metastasis and angiogenesis of various cancer cells, and thus its inhibition can be considered a potential therapeutic strategy. We found
Jordi Codony-Servat et al.
British journal of cancer, 117(12), 1777-1786 (2017-11-11)
Although chemotherapy is the cornerstone treatment for patients with metastatic colorectal cancer (mCRC), acquired chemoresistance is common and constitutes the main reason for treatment failure. Monoclonal antibodies against insulin-like growth factor-1 receptor (IGF-1R) have been tested in pre-treated mCRC patients
Jeong-Hwan Yoon et al.
Nature communications, 6, 7600-7600 (2015-07-22)
Transforming growth factor-β (TGF-β) and interleukin-6 (IL-6) are the pivotal cytokines to induce IL-17-producing CD4(+) T helper cells (TH17); yet their signalling network remains largely unknown. Here we show that the highly homologous TGF-β receptor-regulated Smads (R-Smads): Smad2 and Smad3
Xiaoyun Dai et al.
Molecular oncology, 9(4), 818-833 (2015-01-28)
Deregulated activation of oncogenic transcription factors such as signal transducer and activator of transcription 3 (STAT3) plays a pivotal role in proliferation and survival of hepatocellular carcinoma (HCC). Thus, agents which can inhibit STAT3 activation may have an enormous potential

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.