Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU050391

Sigma-Aldrich

MISSION® esiRNA

targeting human PIAS3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCGGACGGAATTACTCCTTGTCTGTGTACCTGGTGAGGCAGTTGACTGCAGGAACCCTTCTACAAAAACTCAGAGCAAAGGGTATCCGGAACCCAGACCACTCGCGGGCACTGATCAAGGAGAAATTGACTGCTGACCCTGACAGTGAGGTGGCCACTACAAGTCTCCGGGTGTCACTCATGTGCCCGCTAGGGAAGATGCGCCTGACTGTCCCTTGTCGTGCCCTCACCTGCGCCCACCTGCAGAGCTTCGATGCTGCCCTTTATCTACAGATGAATGAGAAGAAGCCTACATGGACATGTCCTGTGTGTGACAAGAAGGCTCCCTATGAATCTCTTATCATTGATGGTTTATTTATGGAGATTCTTAGTTCCTGTTCAGATTGTGATGAGATCCAATTCATGGAAGATGGATCCTGGTGCCCAATGAAACCCAAGAAGGAGGCATCTGAGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jeong-Hyeon Ko et al.
Immunopharmacology and immunotoxicology, 38(5), 334-343 (2016-06-22)
Constitutive activation of signal transducer and activator of transcription 3 (STAT3) is frequently observed and closely linked with proliferation, survival, metastasis and angiogenesis of various cancer cells, and thus its inhibition can be considered a potential therapeutic strategy. We found
Jordi Codony-Servat et al.
British journal of cancer, 117(12), 1777-1786 (2017-11-11)
Although chemotherapy is the cornerstone treatment for patients with metastatic colorectal cancer (mCRC), acquired chemoresistance is common and constitutes the main reason for treatment failure. Monoclonal antibodies against insulin-like growth factor-1 receptor (IGF-1R) have been tested in pre-treated mCRC patients
Jeong-Hwan Yoon et al.
Nature communications, 6, 7600-7600 (2015-07-22)
Transforming growth factor-β (TGF-β) and interleukin-6 (IL-6) are the pivotal cytokines to induce IL-17-producing CD4(+) T helper cells (TH17); yet their signalling network remains largely unknown. Here we show that the highly homologous TGF-β receptor-regulated Smads (R-Smads): Smad2 and Smad3
Xiaoyun Dai et al.
Molecular oncology, 9(4), 818-833 (2015-01-28)
Deregulated activation of oncogenic transcription factors such as signal transducer and activator of transcription 3 (STAT3) plays a pivotal role in proliferation and survival of hepatocellular carcinoma (HCC). Thus, agents which can inhibit STAT3 activation may have an enormous potential

Global Trade Item Number

SKUGTIN
EHU050391-20UG4061831343519
EHU050391-50UG4061828336418

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.