Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU042421

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3C3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCTTTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAACGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAATGAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAAATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAGTTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGATTTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGG

N° accesso Ensembl | uomo

ENSG00000078142

N° accesso NCBI

NM_002647

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PIK3C3(5289) , PIK3C3(5289)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Pierre-Luc Mouchel et al.
Cancers, 12(10) (2020-10-16)
Dendrogenin A (DDA), a mammalian cholesterol metabolite with tumor suppressor properties, has recently been shown to exhibit strong anti-leukemic activity in acute myeloid leukemia (AML) cells by triggering lethal autophagy. Here, we demonstrated that DDA synergistically enhanced the toxicity of
Harilaos Filippakis et al.
Scientific reports, 8(1), 14161-14161 (2018-09-23)
Tuberous Sclerosis Complex (TSC), a rare genetic disorder with mechanistic target of rapamycin complex 1 (mTORC1) hyperactivation, is characterized by multi-organ hamartomatous benign tumors including brain, skin, kidney, and lung (Lymphangioleiomyomatosis). mTORC1 hyperactivation drives metabolic reprogramming including glucose and glutamine
Jian-Kang Chen et al.
The Journal of clinical investigation, 125(6), 2429-2444 (2015-05-20)
Kidney size adaptively increases as mammals grow and in response to the loss of 1 kidney. It is not clear how kidneys size themselves or if the processes that adapt kidney mass to lean body mass also mediate renal hypertrophy
María Cecilia Gimenez et al.
Journal of virology, 95(6) (2020-12-29)
Infectious bursal disease virus (IBDV) is the archetypal member of the family Birnaviridae and the etiological agent of Gumboro disease, a highly contagious immunosuppressive infection of concern to the global poultry sector for its adverse health effects in chicks. Unlike
Asma Boukhalfa et al.
Nature communications, 11(1), 294-294 (2020-01-17)
Cells subjected to stress situations mobilize specific membranes and proteins to initiate autophagy. Phosphatidylinositol-3-phosphate (PI3P), a crucial lipid in membrane dynamics, is known to be essential in this context. In addition to nutriments deprivation, autophagy is also triggered by fluid-flow
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.