Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU039481

Sigma-Aldrich

MISSION® esiRNA

targeting human CLTC

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA

N° accesso Ensembl | uomo

ENSG00000141367

N° accesso NCBI

NM_004859

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CLTC(1213) , CLTC(1213)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Ruobo Zhou et al.
Science (New York, N.Y.), 365(6456), 929-934 (2019-08-31)
Actin, spectrin, and related molecules form a membrane-associated periodic skeleton (MPS) in neurons. The function of the MPS, however, remains poorly understood. Using super-resolution imaging, we observed that G protein-coupled receptors (GPCRs), cell adhesion molecules (CAMs), receptor tyrosine kinases (RTKs)
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Visualizza tutti i documenti correlati

Protocolli

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.