Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU037321

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTG

N° accesso Ensembl | uomo

ENSG00000101665

N° accesso NCBI

NM_005904

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SMAD7(4092) , SMAD7(4092)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Takashi Emori et al.
Biology open, 1(3), 247-260 (2012-12-06)
Smad family proteins are essential intracellular mediators that regulate transforming growth factor-β (TGF-β) ligand signaling. In response to diverse stimuli, Smad7 is rapidly expressed and acts as a cytoplasmic inhibitor that selectively interferes with signals elicited from TGF-β family receptors.
Tianming Liu et al.
Oncology letters, 14(4), 3941-3946 (2017-09-26)
MicroRNA (miR)-590 has been established to be a promoter of cell proliferation, migration and invasion, and an inhibitor of apoptosis in numerous cancer cell lines. However, its effects on non-cancer cells remain to be elucidated. miR-590 was transfected into human
Ratana Lim et al.
Biology of reproduction, 97(2), 288-301 (2017-10-19)
Preterm birth continues to be a significant public health problem. Infection (bacterial and or viral) and inflammation, by stimulating proinflammatory cytokines, adhesion molecules, and matrix metalloproteinase 9 (MMP9), play a central role in the rupture of membranes and myometrial contractions.
Lili Du et al.
Cardiology, 138(1), 55-62 (2017-06-02)
Eplerenone (EPL), an antagonist of the mineralocorticoid receptor, is beneficial for atrial fibrillation and atrial fibrosis. However, the underlying mechanism remains less well known. We aimed to investigate the effect of EPL on atrial fibrosis using a mouse with selective
R B Luwor et al.
Oncogene, 32(19), 2433-2441 (2012-07-04)
Transforming Growth Factor-β (TGF-β) and Epidermal Growth Factor (EGF) signaling pathways are both independently implicated as key regulators in tumor formation and progression. Here, we report that the tumor-associated overexpression of epidermal growth factor receptor (EGFR) desensitizes TGF-β signaling and
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.