Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU037081

Sigma-Aldrich

MISSION® esiRNA

targeting human HAVCR2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCAACCACCTTATTTTTGAGCTTGGTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGACTGGTTTTGGAGGTTCTGTCCACTGCTATGGAGCAGAGTTTTCCCATTTTCAGAAGATAATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAGAGCTCAAACGGGCTTTTATATACACTAGGAATTCTTGACGTGGGGTCTCTGGAGCTCCAGGAAATTCGGGCACATCATA

N° accesso Ensembl | uomo

ENSG00000135077

N° accesso NCBI

NM_032782

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HAVCR2(84868) , HAVCR2(84868)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
PKU
IKU
NJU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Cecilia Fernandez-Ponce et al.
PloS one, 9(1), e85191-e85191 (2014-01-28)
Adaptive T cell responses are critical for controlling HCV infection. While there is clinical evidence of a relevant role for regulatory T cells in chronic HCV-infected patients, based on their increased number and function; mechanisms underlying such a phenomena are
Huapeng Lin et al.
Oncology letters, 14(5), 5899-5905 (2017-11-09)
T-cell immunoglobulin mucin (TIM)-3 is an important member of the TIM gene family, which was thought to contribute to the progression of numerous types of cancer, including hepatocellular carcinoma (HCC); however, the mechanism underlying TIM-3 functions in HCC progression has
Rong-Ti Ge et al.
Immunologic research, 64(2), 470-475 (2015-09-26)
The T helper 1 (Th1) polarization plays a critical role in the pathogenesis of a number of inflammatory disorders in the body; the remedies in the correction of polarized Th1 cells are limited. This study aims to investigate the role
Yong-Rui Piao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(11), 11409-11414 (2014-08-15)
T cell immunoglobulin domain and mucin domain-containing molecule 3 (Tim-3) is a newly discovered immunomodulatory, which plays an important role in immunity regulation. Recent evidence suggests that Tim-3 is differentially regulated in a variety of tumors and has a potential
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.