Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU034191

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGCTGGAACGCAACATAGAGACCATCATCAACACCTTCCACCAATACTCTGTGAAGCTGGGGCACCCAGACACCCTGAACCAGGGGGAATTCAAAGAGCTGGTGCGAAAAGATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACATCATGGAGGACCTGGACACAAATGCAGACAAGCAGCTGAGCTTCGAGGAGTTCATCATGCTGATGGCGAGGCTAACCTGGGCCTCCCACGAGAAGATGCACGAGGGTGACGAGGGCCCTGGCCACCACCATAAGCCAGGCCTCGGGGAGGGCACCCCCTAAGACCACAGTGGCCAAGATCACAGTGGCCACGGCCACGGCCACAGTCATGGTGGCCACGGCCACAGCCACTAATCAGGAGGCCAGGCCACCCTGCCTCTACCCAACCAGGGCCCCGGGGCCTGTTATGTCAAACTGTCTTGGCTGTGG

N° accesso Ensembl | uomo

ENSG00000163220

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... S100A9(6280) , S100A9(6280)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yiwen Zhou et al.
Frontiers in pharmacology, 12, 640521-640521 (2021-04-02)
Hepatic macrophages play a critical role in inflammation caused by alcohol feeding. During this process, variation of macrophage phenotypes triggers inflammatory responses in a variety of ways. Moreover, there is increasing evidence that Brain and Muscle Arnt-Like Protein-1 (Bmal1) is
Liang Peng et al.
Frontiers in cellular and infection microbiology, 10, 47-47 (2020-03-03)
Bacterial infection remains one of the leading causes of death worldwide due to the continuous rise of multiple antibiotic-resistant bacteria. Focusing solely on bacteria as the drug targets is a major limitation inherent in the conventional antibiotic therapy. Recently, host-directed
Ping Wu et al.
Oncology research, 25(9), 1479-1488 (2017-03-10)
Hypopharyngeal cancer (HPC) frequently presents at an advanced stage and displays early submucosal spread, resulting in a poor prognosis. It is among the worst of all cancers in the head and neck subsites. Therefore, detection of HPC at an earlier
Hirokazu Ohata et al.
Cell reports, 28(5), 1282-1295 (2019-08-01)
Cancer stem cells (CSCs) are associated with the refractory nature of cancer, and elucidating the targetable pathways for CSCs is crucial for devising innovative antitumor therapies. We find that the proliferation of CSC-enriched colon spheroids from clinical specimen is dependent
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.