Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU024031

Sigma-Aldrich

MISSION® esiRNA

targeting human SP3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTTCCTGGTCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTCTGCCAGGAAATATTACGTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCTCGGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGACGGACATTTGATAAACACAGGACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATATTAATGAAACTAATACTGATACAGATTTATTTGTGCCAACATCCTCTTCATCACAGTTGCCTGTTACGATAGATAGTACAGGTATATTACAACAAAACACAAATAGCTTGACTACATCTAGTGGGCAGGTTCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAGAGACACAGGCACAGAATATTCAGGTTTCTACAGCACAGCCTGTTGTACAGCATCTACAACTTCAAGAGTCTCAGCAGCCAACCAGT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yan-Yan Xu et al.
Scientific reports, 7(1), 2090-2090 (2017-05-20)
Stimulator of Interferon Gene (STING) is a key mediator of innate immune signaling. STING plays a pivotal role in the pathogenesis of many diseases including infectious diseases, auto-immune diseases and cancer. Many studies have been carried out recently in the
Yinxian Wen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12834-12846 (2020-08-09)
Maternal dexamethasone decreases the body length of the newborn. However, whether dexamethasone inhibits the development of the growth plate of the fetal long bone is still unknown. Here, we found that lengths of fetal femur and growth plate were both
Shawn T Beug et al.
Science signaling, 12(566) (2019-01-31)
The controlled production and downstream signaling of the inflammatory cytokine tumor necrosis factor-α (TNF-α) are important for immunity and its anticancer effects. Although chronic stimulation with TNF-α is detrimental to the health of the host in several autoimmune and inflammatory
Michael A Peplowski et al.
Journal of molecular medicine (Berlin, Germany), 96(10), 1081-1093 (2018-08-10)
Aquaporin (AQP) 3 expression is altered in inflammatory bowel diseases, although the exact mechanisms regulating AQP abundance are unclear. Although interferon gamma (IFNγ) is centrally involved in intestinal inflammation, the effect of this cytokine on AQP3 expression remains unknown. HT-29

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.