Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU020151

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCA

N° accesso Ensembl | uomo

ENSG00000168615

N° accesso NCBI

NM_003816

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ADAM9(8754) , ADAM9(8754)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ADUM
ACKS
SRS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rui Zhou et al.
Frontiers in medicine, 7, 214-214 (2020-07-09)
Upregulation of a disintegrin and metalloprotease 9 (ADAM9) is correlated with progression of cancers, such as prostate, bladder, and pancreatic cancers. However, its role in triple-negative breast cancer (TNBC) is still unclear. Our study aimed to investigate whether ADAM9 is
Jun Arai et al.
Journal of gastroenterology and hepatology, 33(5), 1075-1081 (2017-10-22)
The multi-kinase inhibitor regorafenib (REG) was recently demonstrated to be effective in patients with sorafenib (SOR)-resistant hepatocellular carcinoma (HCC). Interestingly, SOR is known to enhance the accumulation of membrane-bound MHC class I polypeptide-related sequence A (mMICA) in HCC cells and
Mari Ueno et al.
Cancer science, 109(2), 471-482 (2017-12-17)
ADAMs (a disintegrin and metalloproteinases) are involved in various biological events such as cell adhesion, migration and invasion, membrane protein shedding and proteolysis. However, there have been no systematic studies on the expression of ADAMs in human ovarian carcinomas. We
Liang Chang et al.
Molecular medicine reports, 12(1), 1197-1204 (2015-03-18)
A disintegrin and metalloproteinase 9 (ADAM9) is a type I transmembrane protein that has been associated with cancer development and metastasis in various types of cancer. However, little is known about its role in non-small cell lung cancer (NSCLC). The
Kenzo Sonoda et al.
BioMed research international, 2014, 482396-482396 (2014-09-02)
In several human malignancies, the expression of receptor-binding cancer antigen expressed on SiSo cells (RCAS1) is associated with aggressive characteristics and poor overall survival. RCAS1 alters the tumor microenvironment by inducing peripheral lymphocyte apoptosis and angiogenesis, while reducing the vimentin-positive

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.