Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU018291

Sigma-Aldrich

MISSION® esiRNA

targeting human BCAP31

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGA

N° accesso Ensembl | uomo

ENSG00000185825

N° accesso NCBI

NM_005745

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BCAP31(10134) , BCAP31(10134)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shuya Yang et al.
Frontiers in molecular biosciences, 7, 107-107 (2020-06-26)
Cervical cancer (CC) is the most common malignant tumor in gynecology, and metastasis is an important cause of patient death. MiRNAs (microRNAs) have been found to play key roles in cervical cancer metastasis, but the effect of miR-362-3p in CC
Shuya Yang et al.
Cancer medicine, 10(1), 305-316 (2020-11-20)
BAP31 (B-cell receptor-associated protein 31) is an important regulator of intracellular signal transduction and highly expressed in several cancer tissues or testicular tissues. Our previous study had revealed that elevated BAP31 plays a crucial role in the progress and metastasis
Kayo Machihara et al.
Cells, 8(11) (2019-11-02)
Cancer cells modulate their metabolism to proliferate and survive under the metabolic stress condition, which is known as endoplasmic reticulum (ER) stress. Therefore, cancer cells should suppress ER stress-mediated cell death and induce autophagy-which recycles metabolites to provide energy and
Takushi Namba
Science advances, 5(6), eaaw1386-eaaw1386 (2019-06-18)
The endoplasmic reticulum (ER) is composed of large membrane-bound compartments, and its membrane subdomain appears to be in close contact with mitochondria via ER-mitochondria contact sites. Here, I demonstrate that the ER membrane protein, BAP31, acts as a key factor
Won-Tae Kim et al.
Stem cells (Dayton, Ohio), 32(10), 2626-2641 (2014-06-06)
B-Cell receptor-associated protein 31 (BAP31) regulates the export of secreted membrane proteins from the endoplasmic reticulum (ER) to the downstream secretory pathway. Previously, we generated a monoclonal antibody 297-D4 against the surface molecule on undifferentiated human embryonic stem cells (hESCs).

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.