Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU017941

Sigma-Aldrich

MISSION® esiRNA

targeting human FPR2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAATCCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTCCCTTTCAACTGG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yi Xiang et al.
American journal of cancer research, 6(11), 2599-2610 (2016-12-03)
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human
Liang Zong et al.
Journal of experimental & clinical cancer research : CR, 36(1), 181-181 (2017-12-13)
Pancreatic cancer is a lethal disease in part because of its potential for aggressive invasion and metastasis. Lipoxin A4 (LXA4) is one of the metabolites that is derived from arachidonic acid and that is catalyzed by 15-lipoxygenase (15-LOX), and it
Maayan Pereg et al.
PloS one, 14(6), e0217681-e0217681 (2019-06-07)
The ability to efficiently perform actions immediately following instructions and without prior practice has previously been termed Rapid Instructed Task Learning (RITL). In addition, it was found that instructions are so powerful that they can produce automatic effects, reflected in
Shixun Wang et al.
BioMed research international, 2016, 4819327-4819327 (2016-03-24)
Visfatin has been reported to exert an important role in the development of atherosclerosis. However, the mechanism that regulated the expression of Visfatin has not been elucidated yet. This study aimed to investigate the effect of SAA on the regulation
Mi-Sook Lee et al.
Cellular signalling, 27(7), 1439-1448 (2015-04-12)
Vascular endothelial growth factor-A (VEGF-A) is a master regulator of angiogenesis that controls several angiogenic processes in endothelial cells. However, the detailed mechanisms of VEGF-A responsible for pleiotropic functions and crosstalk with other signaling pathways have not been fully understood.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.