Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

Altri documenti

EHU015561

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAU

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGG

N° accesso Ensembl | uomo

ENSG00000122861

N° accesso NCBI

NM_002658

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PLAU(5328) , PLAU(5328)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Peng Liu et al.
Scientific reports, 6, 37606-37606 (2016-11-22)
Pancreatic cancer is a highly metastatic and chemo-resistant disease. Secreted proteins involved in cell-cell interactions play an important role in changing the tumor microenvironment. Previous studies generally focus on the secretome of cancer cell line from serum-free media, due to
Anuradha Moirangthem et al.
Scientific reports, 6, 21903-21903 (2016-02-26)
In cancer progression, proteolytic enzymes like serine proteases and metalloproteinases degrade the basement membrane enabling the tumor cells to invade the adjacent tissues. Thus, invasion and metastasis are augmented by these enzymes. Simultaneous silencing of uPA and MMP9 in breast
Xin Zhao et al.
European journal of pharmacology, 880, 173225-173225 (2020-05-29)
Tripterygium wilfordii Hook F (TwHF) exhibits anti-tumor efficacy in pancreatic ductal adenocarcinoma (PDAC), however the pharmacological mechanisms are unclear due to complicated formulae and target genes. Using Traditional Chinese Medicine Systems Pharmacology and GeneCards databases, we performed a network pharmacology
Rishi K Jaiswal et al.
BioFactors (Oxford, England), 45(5), 803-817 (2019-07-19)
Telomerase is a specialized reverse transcriptase/terminal transferase enzyme that adds telomeric repeat sequences at the extreme end of a newly replicated chromosome. Apart from telomere lengthening, telomerase has many extracurricular activities. Telomerase is known to regulate the expression of many
Hai Li et al.
Integrative cancer therapies, 17(2), 511-523 (2017-06-20)
Gastric cancer (GC) is a malignancy with few effective treatment options after metastasis occurs. Quercetin (Qu) intake has been associated with reduced incidence and slow development of GC, probably due to its anti-proliferative and apoptotic effects, but it is unclear
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.