Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU015411

Sigma-Aldrich

MISSION® esiRNA

targeting human DAPK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAAATGTATCCGCTGTCAACTACGAATTTGAGGATGAATACTTCAGTAATACCAGTGCCCTAGCCAAAGATTTCATAAGAAGACTTCTGGTCAAGGATCCAAAGAAGAGAATGACAATTCAAGATAGTTTGCAGCATCCCTGGATCAAGCCTAAAGATACACAACAGGCACTTAGTAGAAAAGCATCAGCAGTAAACATGGAGAAATTCAAGAAGTTTGCAGCCCGGAAAAAATGGAAACAATCCGTTCGCTTGATATCACTGTGCCAAAGATTATCCAGGTCATTCCTGTCCAGAAGTAACATGAGTGTTGCCAGAAGCGATGATACTCTGGATGAGGAAGACTCCTTTGTGATGAAAGCCATCATCCATGCCATCAACGATGACAATGTCCCAGGCCTGCAGCACCTTCTGGGCTCATTATCCA

N° accesso Ensembl | uomo

ENSG00000196730

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DAPK1(1612) , DAPK1(1612)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
XWU
JUU
WQU
ETS
DZR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhenning Liu et al.
Immunologic research, 65(3), 687-698 (2017-02-20)
Paraquat can result in dysfunction of multiple organs after ingestion in human. However, the mechanisms of nucleotide-binding domain and leucine-rich repeat containing protein 3 (NLRP3) inflammasome activation in acute kidney injury have not been clearly demonstrated. The aim of this
Wei Xiong et al.
Journal of the neurological sciences, 387, 210-219 (2018-03-25)
Death-associated protein kinase 1 (DAPK1) is a kinase found to promote neuronal apoptosis induced by ischemia. Extracellular signal-regulated kinase (ERK) was identified as a key molecule in DAPK1 signaling. However, the mechanisms of neuronal ischemia reperfusion injury remain unknown. Here
Chang-Lin Zhai et al.
IUBMB life, 71(2), 166-176 (2018-11-13)
Cardiovascular ischemic disease is a large class of diseases that are harmful to human health. The significant role of microRNAs (miRNAs) in terms of controlling cardiac injury has been reported in latest studies. MiR-98 is very important in regulating the
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Jean-Cheng Kuo et al.
The Journal of cell biology, 172(4), 619-631 (2006-02-16)
Death-associated protein kinase (DAPK) is a calmodulin-regulated serine/threonine kinase and possesses apoptotic and tumor-suppressive functions. However, it is unclear whether DAPK elicits apoptosis-independent activity to suppress tumor progression. We show that DAPK inhibits random migration by reducing directional persistence and
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.