Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU010531

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP9

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGACAGCGACAAGAAGTGGGGCTTCTGCCCGGACCAAGGATACAGTTTGTTCCTCGTGGCGGCGCATGAGTTCGGCCACGCGCTGGGCTTAGATCATTCCTCAGTGCCGGAGGCGCTCATGTACCCTATGTACCGCTTCACTGAGGGGCCCCCCTTGCATAAGGACGACGTGAATGGCATCCGGCACCTCTATGGTCCTCGCCCTGAACCTGAGCCACGGCCTCCAACCACCACCACACCGCAGCCCACGGCTCCCCCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTCAGAGCGCCCCACAGCTGGCCCCACAGGTCCCCCCTCAGCTGGCCCCACAGGTCCCCCCACTGCTGGCCCTTCTACGGCCACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACG

N° accesso Ensembl | uomo

ENSG00000100985

N° accesso NCBI

NM_004994

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MMP9(4318) , MMP9(4318)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
DCV
NBV
ELT
OAT
JBS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jiaoli Wang et al.
Oncotarget, 8(47), 81880-81891 (2017-11-16)
Obesity is involved in tumor progression. However, the corresponding mechanisms remain largely unknown. Here, we report that adipocytes increase the invasive ability of tumor cells by producing exosomes with a high level of MMP3. Compared with 3T3-L1 cells, 3T3-L1 adipocytes
Xue Bai et al.
OncoTargets and therapy, 10, 2837-2847 (2017-06-28)
Epithelial-mesenchymal transition (EMT) is thought to be a crucial event during the early metastasis of tumor cells. Transforming growth factor (TGF)-β1 is involved in the process of EMT in a variety of human malignancies. Matrix metalloproteinase (MMP)-9 plays an important
Hang Lin et al.
FEBS open bio, 7(9), 1291-1301 (2017-09-15)
Dysregulation of sirtuin 6 (SIRT6) is actively involved in tumor progression. High levels of SIRT6 have been associated with hepatocellular carcinoma and non-small cell lung cancer, and SIRT6 facilitates growth and metastasis of cancer cells. However, the clinical significance and
Jon M Florence et al.
PloS one, 12(2), e0171427-e0171427 (2017-02-07)
The atherosclerotic process begins when vascular endothelial cells undergo pro-inflammatory changes such as aberrant activation to dysfunctional phenotypes and apoptosis, leading to loss of vascular integrity. Our laboratory has demonstrated that exposure of mice to second hand smoke triggers an
Haibin Lu et al.
American journal of translational research, 9(12), 5361-5374 (2018-01-10)
Tumor-associated neutrophils (TANs) promote metastasis of multiple cancers, including oral squamous cell carcinoma (OSCC). Melatonin (Mel) reportedly exerts anti-metastatic effects on OSCC. However, little is known about the anti-OSCC effects of Mel involved in TANs. In this study, intensive infiltration
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.