Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU010441

Sigma-Aldrich

MISSION® esiRNA

targeting human VDR

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yang Gao et al.
International journal of molecular medicine, 46(4), 1538-1550 (2020-09-19)
Psoriasis is an immune‑mediated dermatosis characterized by T‑lymphocyte‑mediated epidermal hyperplasia, for which there are currently no effective clinical treatments. 'Psoriasis 1' is a Chinese herbal medicine formulation that has been recently used extensively in China for treating patients with psoriasis. However
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Aurélien Mary et al.
Endocrinology, 156(6), 1965-1974 (2015-03-13)
Vascular calcification (VC) is a degenerative disease that contributes to cardiovascular morbidity and mortality. A negative relationship has been demonstrated between VC and calcium sensing receptor (CaSR) expression in the vasculature. Of interest, vitamin D response elements, which allow responsiveness
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.