Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

View All Documentation

EHU010021

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGAC

N° accesso Ensembl | uomo

ENSG00000179348

N° accesso NCBI

NM_032638

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... GATA2(2624) , GATA2(2624)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Carole-Anne Whigham et al.
Scientific reports, 9(1), 235-235 (2019-01-20)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and organ injury. GATA2 is a transcription factor expressed in the endothelium which regulates vascular homeostasis by controlling transcription of genes and microRNAs, including
Siyan Chen et al.
Molecular immunology, 123, 32-39 (2020-05-16)
At present, most studies on the relationship between hepatitis B virus (HBV) and IL-33/ST2 axis focus on clinical detection, but the underlying molecular mechanisms of HBx and IL-33/ST2 axis regulation and Th cell function regulation have not been explored. In
Fuwen Yuan et al.
Nucleic acids research, 47(19), 10104-10114 (2019-09-11)
Enzalutamide, a second-generation androgen receptor (AR) antagonist, has demonstrated clinical benefit in men with prostate cancer. However, it only provides a temporary response and modest increase in survival, indicating a rapid evolution of resistance. Previous studies suggest that enzalutamide may
Cong Qiu et al.
Nature communications, 8, 15426-15426 (2017-06-02)
Data from clinical research and our previous study have suggested the potential involvement of SENP1, the major protease of post-translational SUMOylation, in cardiovascular disorders. Here, we investigate the role of SENP1-mediated SUMOylation in graft arteriosclerosis (GA), the major cause of
Mark A Gillespie et al.
Molecular cell, 78(5), 960-974 (2020-04-25)
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.