Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU009241

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB6 (2)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCCATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTTATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAGCTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGAACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGCCATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACAGCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAGCCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

N° accesso Ensembl | uomo

ENSG00000115221

N° accesso NCBI

NM_000888

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ITGB6(3694) , ITGB6(3694)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ACNV
GYR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Robert J Slack et al.
Pharmacology, 97(3-4), 114-125 (2016-01-07)
A20FMDV2 is a peptide derived from the foot-and-mouth disease virus with a high affinity and selectivity for the alpha-v beta-6 (αvβ6) arginyl-glycinyl-aspartic acid (RGD)-binding integrin. It has been shown to be an informative tool ligand in pre-clinical imaging studies for
Jiarui Bi et al.
Cytokine, 114, 135-142 (2018-11-24)
Epithelial αvβ6 integrin participates in immune surveillance in many organs, including the gastrointestinal track. Expression of αvβ6 integrin is reduced in the junctional epithelium of the gingiva in periodontal diseases, and mutations in the ITGB6 gene are associated with these
Runhong Han et al.
JCI insight, 4(7) (2019-04-05)
Chronic tubulointerstitial injury impacts the prognosis of focal segmental glomerulosclerosis (FSGS). We found that the level of versican V1 was increased in tubular cells of FSGS patients. Tubular cell-derived versican V1 induced proliferation and collagen synthesis by activating the CD44/Smad3
Jiarui Bi et al.
Scientific reports, 7(1), 4411-4411 (2017-07-02)
Periodontal diseases manifest by the formation of deep pockets between the gingiva and teeth where multispecies bacterial biofilms flourish, causing inflammation and bone loss. Epithelial cell receptor αvβ6 integrin that regulates inflammation by activating the anti-inflammatory cytokine transforming growth factor-β1

Protocolli

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.