Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU004551

Sigma-Aldrich

MISSION® esiRNA

targeting human STS

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATTCATGGCGGAAGTAATGGGATCTATAAAGGAGGAAAAGCAAACAACTGGGAAGGAGGTATCCGGGTTCCAGGCATCCTTCGTTGGCCCAGGGTGATACAGGCTGGCCAGAAGATTGATGAGCCCACTAGCAACATGGACATATTTCCTACAGTAGCCAAGCTGGCTGGAGCTCCCTTGCCTGAGGACAGGATCATTGATGGACGTGATCTGATGCCCCTGCTTGAAGGAAAAAGCCAACGCTCCGATCATGAGTTTCTCTTCCATTACTGCAACGCCTACTTAAATGCTGTGCGCTGGCACCCTCAGAACAGCACATCCATCTGGAAGGCCTTTTTCTTCACCCCCAACTTCAACCCCGTGGGTTCCAACGGATGCTTTGCCACACACGTGTGCTTCTGTTTCGGGAGTTATGTCACCCATCACGACCCACCTTTAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... STS(412) , STS(412)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hee-Jung Im et al.
Biomolecules & therapeutics, 20(6), 556-561 (2013-09-07)
Steroid sulfatase (STS) is responsiblefor the conversion of estrone sulfate to estrone that can stimulate growth in endocrine-dependent tumors such as prostate cancer. Although STS is considered as a therapeutic target for the estrogen-dependent diseases, cellular function of STS are
Cameron M Armstrong et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6064-6074 (2020-09-16)
Most patients with prostate cancer receiving enzalutamide or abiraterone develop resistance. Clinical evidence indicates that serum levels of dehydroepiandrosterone sulfate (DHEAS) and biologically active DHEA remain in the high range despite antiandrogen treatment. The conversion of DHEAS into DHEA by
Amy M Gratton et al.
Placenta, 48, 72-79 (2016-11-23)
Preeclampsia is a serious complication of pregnancy affecting 5% of pregnancies. Our team identified 137 genes highly expressed in placenta relative to other human tissues. Here, we have explored a role for steroid sulfatase (STS) in preeclampsia by characterising STS
Mengxi Jiang et al.
Journal of hepatology, 64(1), 44-52 (2015-07-30)
Chronic inflammatory liver diseases are associated with estrogen excess and feminization in men, which is thought to be due to compromised liver function to break down estrogens. The goal of this study is to determine whether the inflammatory induction of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.