Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU002141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTGAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Weiran Liu et al.
Oncotarget, 8(1), 179-190 (2016-06-23)
As shortened telomeres inhibit tumor formation and prolong life span in a KrasG12D mouse lung cancer model, we investigated the implications of telomerase in Kras-mutant NSCLC. We found that Kras mutations increased TERT (telomerase reverse transcriptase) mRNA expression and telomerase
Ching-Ting Wei et al.
Anticancer research, 39(2), 695-701 (2019-02-04)
Sorafenib is now standard treatment for advanced hepatocellular carcinoma (HCC). However, therapeutic efficacy is not as good as was predicted. Many efforts are being made to improve HCC sensitivity to sorafenib. Our previous study demonstrated that co-treatment with chrysin enhanced
Yiqun Huang et al.
Oncology reports, 41(1), 377-386 (2018-10-27)
MAPK kinase 1 (MEK1) is an upstream protein kinase of extracellular signal regulated kinase (ERK), which activates the ERK/MAPK (mitogen activated protein kinase) pathway. Importantly, bioinformatic analysis has shown that there is a target complementary binding site between miR‑101 and MEK1.
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.