Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU079511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atf4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCTGTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATATCTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAAGACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCGGAGTCCTACCTGGGCTCTCCCCAGCATAGCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGG

Numéro d'accès Ensembl | souris

ENSMUSG00000042406

Numéro d'accès NCBI

NM_009716

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... ATF4(11911) , Atf4(11911)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
Kyong-Jin Jung et al.
Oncotarget, 6(3), 1556-1568 (2015-01-19)
Carnosic acid is a phenolic diterpene from rosmarinus officinalis, and has multiple functions, such as anti-inflammatory, anti-viral, and anti-tumor activity. In this study, we examined whether carnosic acid could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found
Enni Markkanen et al.
Nucleic acids research, 43(7), 3667-3679 (2015-03-25)
Genetic instability, provoked by exogenous mutagens, is well linked to initiation of cancer. However, even in unstressed cells, DNA undergoes a plethora of spontaneous alterations provoked by its inherent chemical instability and the intracellular milieu. Base excision repair (BER) is
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in
Souvik Dey et al.
The Journal of clinical investigation, 125(7), 2592-2608 (2015-05-27)
The integrated stress response (ISR) is a critical mediator of cancer cell survival, and targeting the ISR inhibits tumor progression. Here, we have shown that activating transcription factor 4 (ATF4), a master transcriptional effector of the ISR, protects transformed cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique