Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU152091

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAAATGCAAACTGGATGATGACATGAACCTGCTGGATATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAAAGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTCAGCAAAGAGAGAAGCAGCAGCCTTGAAGGAAGTCCTGATGAATTTTCAAATGACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAACAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAGGAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGAGATCAAGCCCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bin Xu et al.
Oncology research, 25(7), 1161-1168 (2017-01-22)
Currently, multiple microRNAs (miRNAs) have been found to play vital roles in the pathogenesis of osteosarcoma. This study aimed to investigate the role of miR-21 in osteosarcoma. The level of miR-21 in 20 pairs of osteosarcoma and corresponding adjacent tissues
Biswajit Podder et al.
Cell death and differentiation, 26(12), 2520-2534 (2019-03-10)
Melanoma cells are highly resistant to conventional genotoxic agents, and BRAFV600/MEK-targeted therapies as well as immunotherapies frequently remain inefficient. Alternative means to treat melanoma, in particular through the induction of programmed cell death modalities such as apoptosis or necroptosis, therefore
Jong-Heon Won et al.
Molecules (Basel, Switzerland), 23(12) (2018-12-16)
The natural product 23-hydroxyursolic acid (23-HUA) is a derivative of ursolic acid, which is known to induce cancer cell apoptosis. However, apoptotic effects and mechanisms of 23-HUA have not been well characterized yet. Herein, we investigated the molecular mechanisms of
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Nyree Crawford et al.
Cell death and differentiation, 25(11), 1952-1966 (2018-03-04)
Apoptosis resistance contributes to treatment failure in colorectal cancer (CRC). New treatments that reinstate apoptosis competency have potential to improve patient outcome but require predictive biomarkers to target them to responsive patient populations. Inhibitor of apoptosis proteins (IAPs) suppress apoptosis

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique