Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU130201

Sigma-Aldrich

MISSION® esiRNA

targeting human TPD52

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGAGACCCTCTCGGAAGAGGAGCAGGAAGAGCTAAGAAGAGAACTTGCAAAGGTAGAAGAAGAAATCCAGACTCTGTCTCAAGTGTTAGCAGCAAAAGAGAAGCATCTAGCAGAGATCAAGCGGAAACTTGGAATCAATTCTCTACAGGAACTAAAACAGAACATTGCCAAAGGGTGGCAAGACGTGACAGCAACATCTGCTTACAAGAAGACATCTGAAACCTTATCCCAGGCTGGACAGAAGGCCTCAGCTGCTTTTTCGTCTGTTGGCTCAGTCATCACCAAAAAGCTGGAAGATGTAAAAAACTCCCCAACTTTTAAATCATTTGAAGAAAAGGTCGAAAACTTAAAGGCAATAGGGGGAACCAAGCCTGCTGGTGGTGATTTTGGAGAAGTCTTGAATTCGGCTGCAAATGCTAGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Min Fu et al.
International journal of oncology, 57(2), 574-586 (2020-05-30)
Salivary adenoid cystic carcinoma (SACC) exhibits slow continuous growth, frequent local recurrences and a high incidence of blood metastasis, with advanced lung metastasis frequently occurring and being among the primary causes of mortality. MicroRNAs (miR) serve a significant role in the
Yuyan Chen et al.
Scientific reports, 9(1), 9790-9790 (2019-07-07)
Tumor protein D52 (TPD52) is amplified and overexpressed in breast and prostate cancers which are frequently characterised by dysregulated lipid storage and metabolism. TPD52 expression increases lipid storage in mouse 3T3 fibroblasts, and co-distributes with the Golgi marker GM130 and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique