Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU108041

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGTGTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCACTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCAGCATGTGGTGTCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGGAGCGCACTGCCCTCCACAGACACCAGACAGGCCGGACCTGCCACAAGTGTGGGACCCAGCTGCGGGACACCATTGTGCACTTTGGGGAGAGGGGGACGTTGGGGCAGCCTTTGAACTGGGAAGCGACCGAGGCTGCCAGCAGAGCAGACACCATCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Romain Haider et al.
Oncotarget, 8(44), 77309-77316 (2017-11-05)
Predictive biomarkers for advanced prostate cancer (PCa) are still missing. The sirtuin 7 (SIRT7) has been linked to tumorogenesis but its role in prostate cancer is poorly documented. To determine if SIRT7 can be a biomarker for aggressive prostate cancer
Bin Jia et al.
IUBMB life, 73(1), 264-272 (2020-12-17)
Oral squamous cell carcinoma (OSCC) is a common malignant cancer with unfavorable prognosis, and the epithelial-to-mesenchymal transition (EMT) is a critical contributor to OSCC metastasis. Recently, we have shown that sirtuin 7 (Sirt7) is associated with EMT and OSCC metastasis
Anne E Wyman et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L945-L958 (2017-04-08)
Pulmonary fibrosis is a severe condition with no cure and limited therapeutic options. A better understanding of its pathophysiology is needed. Recent studies have suggested that pulmonary fibrosis may be driven by accelerated aging-related mechanisms. Sirtuins (SIRTs), particularly SIRT1, SIRT3
Wang Wei et al.
American journal of cancer research, 7(9), 1788-1803 (2017-10-06)
It is still a controversy whether the role of Sirtuin 7 (SIRT7) is an oncogene or a tumor suppressor gene in cancer as SIRT7 may have different functions in different types of cancer. Particularly, the specific roles of SIRT7 in
Wenzhi Li et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 100, 257-266 (2018-02-14)
Accumulating evidence indicates that sirtuin7 (SIRT7) plays an oncogenic role in the main types of liver cancer, hepatocellular carcinoma (HCC). Nevertheless, the clinical significance of SIRT7 and its role in cholangiocarcinoma (CCA) is largely undiscovered. Here, we found that SIRT7

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique