Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU057281

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATGAAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAACTCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTACAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCC

Numéro d'accès Ensembl | humain

ENSG00000112242

Numéro d'accès NCBI

NM_001949

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... E2F3(1871) , E2F3(1871)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhicai Feng et al.
OncoTargets and therapy, 11, 5303-5313 (2018-09-15)
Melanoma is a malignant tumor that seriously affects patients. The pathogenesis of malignant melanoma is complex, and the cell cycle is closely related to tumor progression. Based on the catalog of cancer somatic mutations, we found that overexpression of the
Junsheng Guo et al.
International journal of clinical and experimental pathology, 13(3), 587-596 (2020-04-10)
Bladder cancer is a common, serious disease worldwide. MicroRNAs (miRNAs) have been reported to participate in the development and progression in many cancers, including bladder cancer. However, the exact roles of miR-22 in bladder cancer process and its underlying mechanism
Satoko Nakashima et al.
European journal of dermatology : EJD, 27(5), 464-471 (2017-07-26)
Although angiosarcoma exhibits aggressive progression and is associated with unfavourable prognosis, its pathogenesis is poorly understood. In the present study, we investigated the possibility that microRNAs play a role in the pathogenesis of angiosarcoma. microRNA expression was evaluated by array
Sivakumar Vadivel Gnanasundram et al.
Nature communications, 8(1), 2103-2103 (2017-12-14)
The c-myc oncogene stimulates ribosomal biogenesis and protein synthesis to promote cellular growth. However, the pathway by which cells sense and restore dysfunctional mRNA translation and how this is linked to cell proliferation and growth is not known. We here
Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique