Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU023641

Sigma-Aldrich

MISSION® esiRNA

targeting human NR2F2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAACTGCCACTCGTACCTGTCCGGATATATTTCCCTGCTGTTGCGCGCGGAGCCCTATCCCACGTCGCGCTTCGGCAGCCAATGCATGCAGCCCAACAACATCATGGGTATCGAGAACATTTGCGAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAGTGGGCCCGGAACATCCCCTTCTTCCCCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACCTGGAGCGAGCTGTTTGTGTTGAATGCGGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCCGCCGCCGGCCTGCATGCTTCGCCCATGTCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGGATCTTCCAAGAGCAAGTGGAGAAGCTCAAGGCGCTGCACGTTGACTCAGCCGAGTACAGCTGCCTCAAGGCCATAGTCCTGTTCACCTCAGATGCCTGTGGTCTCTCTGATGTAGCCCATGTGGAAAGC

Numéro d'accès Ensembl | humain

ENSG00000185551

Numéro d'accès NCBI

NM_021005

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NR2F2(7026) , NR2F2(7026)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Baoguo Zhou et al.
Molecular carcinogenesis, 55(12), 2260-2267 (2016-01-23)
Colorectal cancer (CRC) is one of the leading causes of cancer death worldwide. MiR-382 has been found to have a decreased expression and the ability to suppress tumorigenesis in certain cancers. However, the role of miR-382 in CRC has not
Shigeaki Kanatani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(36), E4985-E4994 (2015-08-26)
The preoptic area (POa) of the rostral diencephalon supplies the neocortex and the amygdala with GABAergic neurons in the developing mouse brain. However, the molecular mechanisms that determine the pathway and destinations of POa-derived neurons have not yet been identified.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique