Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU035581

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCTGACTCTCTGGGCTGTGATCGATTGGGCTGCTTTAACCTCAGCATCCGAGGGCATGGGGAATGCGTTGAATATGTCAAGAGCTTCAATATCCCTCTACTCGTGCTGGGTGGTGGTGGTTATACTGTCCGAAATGTTGCCCGCTGCTGGACATATGAGACATCGCTGCTGGTAGAAGAGGCCATTAGTGAGGAGCTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGACTTCACACTTCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACCTGAAGATGCTGAACCATGCACCTAGTGTCCAGATTCATGACGTGCCTGCAGACCTCCTGACCTATGACAGGACTGATGAGGCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuyao Yin et al.
Cell death & disease, 8(6), e2856-e2856 (2017-06-02)
Histone deacetylase 3 (HDAC3) has an oncogenic role in apoptosis and contributes to the proliferation of cancer cells. MI192 is a novel HDAC3-specific inhibitor that displays antitumor activity in many cancer cell lines. However, the role of HDAC3 and the
Jingzhu Zhang et al.
Frontiers in molecular neuroscience, 10, 395-395 (2017-12-15)
The impairment of amyloid-β (Aβ) clearance in the brain plays a causative role in Alzheimer's disease (AD). Polarity distribution of aquaporin-4 (AQP4) is important to remove Aβ from brain. AQP4 polarity can be influenced by the ratio of two AQP4
A Krell et al.
Neuropathology and applied neurobiology, 45(5), 441-458 (2018-12-15)
Aberrant expression of microRNAs (miRNAs) is frequent in various cancers including gliomas. We aimed to characterize the role of miR-16-5p as a candidate tumour suppressor miRNA in gliomas. Real-time PCR-based approaches were used for miRNA and mRNA expression profiling of
Mohammed Ghiboub et al.
Frontiers in immunology, 11, 550769-550769 (2020-10-31)
Histone deacetylases (HDACs) are a group of enzymes that control histone deacetylation and bear potential to direct expression of large gene sets. We determined the effect of HDAC inhibitors (HDACi) on human monocytes and macrophages, with respect to their polarization
Tomoharu Kuboyama et al.
Scientific reports, 7(1), 8641-8641 (2017-08-19)
Following spinal cord injury (SCI), the innate immune response of microglia and infiltrating macrophages clears up cellular debris and promotes tissue repair, but it also inflicts secondary injury from inflammatory responses. Immunomodulation aimed at maximizing the beneficial effects while minimizing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique