Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU050591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACCTCTCTCCTCCAACGTGGCCACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTGCCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAAGGAGCAAAAGGGTCAGAGGGGGGCCTGGGTCGGTCGGTCGCCTCTCCTCCGAGGCACATGGCACAAGCACAAAAATCCAGCCCCAACGGTCGGTAGCTCCCAGTGAGCCAGGGGCAGATTGGCTTCTTCCTCAGGCCCTCCACTCCCGCAGAGTAGAGCTGGCAGGACCTGGAATTCGTCTGAGGGGAGGGGGAGCTGCCACCTGCTTTCCCCCCTCCCCCAGCTCCAGCTTCTTTCAAGTGGAGCCAGCCGGCCTGGCCTGGTGGGACAATACCTTTGACAAGCGGACTCTCC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000053113

NCBI-Hinterlegungsnummer

NM_007707

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... SOCS3(12702) , Socs3(12702)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shusheng Che et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6805-6811 (2015-04-05)
Malignant glioma is the most common intracranial tumor with poor prognosis. It is well believed that glioma stem cells (GSCs) are responsible for the initiation and progression of glioma. Janus kinase/signal transducer and activator of transcription (Jak/STAT3) pathway plays a
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
E-J Choi et al.
Scandinavian journal of immunology, 82(4), 337-344 (2015-06-16)
Varicella-zoster virus (VZV) is an important viral pathogen that is responsible for causing varicella (chickenpox) and herpes zoster (shingles). VZV has been shown to suppress early anti-viral innate immune responses, but the exact mechanisms are not yet well understood. Here
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.