Direkt zum Inhalt
Merck

EMU028861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1c

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGAGTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTAGAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGATCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

H M Coley et al.
British journal of cancer, 106(3), 482-489 (2012-01-12)
Carboplatin remains a first-line agent in the management of epithelial ovarian cancer (EOC). Unfortunately, platinum-resistant disease ultimately occurs in most patients. Using a novel EOC cell line with acquired resistance to carboplatin: PEO1CarbR, genome-wide micro-array profiling identified the cyclin-dependent kinase
Elizabeth M Algar et al.
PloS one, 4(2), e4482-e4482 (2009-02-18)
SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular
Jihong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 7-14 (2015-05-12)
MicroRNAs (miRNA) have oncogenic or tumor-suppressive roles in the development and growth of human glioma. Glioma development is also associated with alteration in the activities and expression of cell cycle regulators, and miRNAs are emerging as important regulators of cell

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.