Direkt zum Inhalt
Merck

EMU023861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nampt

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCACCGACTCGTACAAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGGAAGGTGAAATACGAGGAAACAGTATTTTATGGGTTGCAGTACATTCTTAATAAGTACTTAAAAGGTAAAGTAGTGACCAAAGAGAAAATCCAGGAGGCCAAAGAAGTGTACAGAGAACATTTCCAAGATGATGTCTTTAACGAAAGAGGATGGAACTACATCCTTGAGAAATACGATGGTCATCTCCCGATTGAAGTAAAGGCTGTTCCCGAGGGCTCTGTCATCCCCAGAGGGAACGTGCTGTTCACAGTGGAAAACACAGACCCAGAGTGCTACTGGCTTACCAATTGGATTGAGACTATTCTTGTTCAGTCCTGGTATCCAATTACAGTGGCCACAA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xu He et al.
Experimental cell research, 352(1), 45-52 (2017-02-06)
Decreased bone volume and strength with aging and enhanced risk of fractures are in part due to reduced number of bone-forming mesenchymal stem cells (MSCs) and cellular dysfunction. In a previous study, we found that osteogenic differentiation of the multipotent
Min Ling et al.
Cell & bioscience, 7, 27-27 (2017-05-27)
Bone degenerative disorders like osteoporosis may be initiated by age-related shifts in anabolic and catabolic responses that control bone homeostasis. Although there are studies suggesting that metabolic changes occur with stem cell differentiation, the molecular mechanisms governing energy metabolism and
Xia Wang et al.
Scientific reports, 5, 12657-12657 (2015-08-01)
Nicotinamide phosphoribosyltransferase (NAMPT) is a promising antitumor target. Novel NAMPT inhibitors with diverse chemotypes are highly desirable for development of antitumor agents. Using high throughput screening system targeting NAMPT on a chemical library of 30000 small-molecules, we found a non-fluorescent
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.