Direkt zum Inhalt
Merck

EHU107461

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6KB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Suleman S Hussain et al.
Cancer letters, 433, 232-241 (2018-07-14)
Radiation therapy (XRT) is a standard treatment for prostate cancer (PCa). Although dose escalation increases local control, toxicity hampers further escalation. Broader improvement will be possible by the addition of adjuvant therapies, which can synergize with radiation and thus improve
Subin Jin et al.
Journal of Korean medical science, 32(8), 1327-1336 (2017-07-01)
Microarray analysis was used to investigate the lack of identified mammalian target of rapamycin (mTOR) pathway downstream genes to overcome cross-talk at non-muscle invasive high-grade (HG)-urothelial carcinoma (UC) of the bladder, gene expression patterns, gene ontology, and gene clustering by
Tao Zhang et al.
International journal of molecular sciences, 15(2), 3154-3171 (2014-02-26)
The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), either alone or in combination with other anti-cancer agents, has been considered as a new strategy for anti-cancer therapy. In this study, we demonstrated that evodiamine, a quinolone alkaloid isolated from the fruit
Ju Hyun Shin et al.
Scientific reports, 3, 1561-1561 (2013-03-28)
There is growing interest in identifying regulators of autophagy. The molecular mechanism underlying transforming growth factor-β activated kinase 1 (TAK1)-induced autophagy is poorly understood. We found that TAK1 inhibits p70 S6 kinase1 (S6K1) phosphorylation by interfering interaction of raptor with
Ye Wang et al.
International journal of radiation biology, 93(6), 581-589 (2017-03-10)
Ribosomal S6 kinase 1 (S6K1) plays an important role in cell proliferation, protein translation and cell survival. This study investigated the possibility of using S6K1 as a new target in the radiotherapy of non-small cell lung cancer (NSCLC) and its

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.