Direkt zum Inhalt
Merck

EHU079921

Sigma-Aldrich

MISSION® esiRNA

targeting human MCL1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Michaela Ohmer et al.
Cell death & disease, 7(8), e2340-e2340 (2016-08-19)
Infection of mammalian cells with viruses often induces apoptosis. How the recognition of viruses leads to apoptosis of the infected cell and which host cell factors regulate this cell death is incompletely understood. In this study, we focussed on two
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Mu He et al.
PloS one, 11(11), e0166896-e0166896 (2016-11-23)
Pancreatic cancer is a fatal malignancy worldwide and urgently requires valid therapies. Previous research showed that the HDAC inhibitor chidamide is a promising anti-cancer agent in pancreatic cancer cell lines. In this study, we elucidate a probable underlying anti-cancer mechanism
Yuzu Zhao et al.
Cell death & disease, 8(10), e3133-e3133 (2017-10-27)
Demethylzeylasteral is one of the extracts of Tripterygium wilfordii Hook F, which plays important roles in multiple biological processes such as inflammation inhibition, as well as immunosuppression. However, anti-cancer function and the underlying mechanisms of demethylzeylasteral in melanoma cells remain

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.