Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU065921

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCAGTGGCTCTTGAAATTGGGGCTGACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTAGCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCTCCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTACCTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCTATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTTTGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCC

Ensembl | Human Hinterlegungsnummer

ENSG00000100462

NCBI-Hinterlegungsnummer

NM_006109

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PRMT5(10419) , PRMT5(10419)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem./physiol. Wirkung

PRMTs (protein arginine N-methyltransferases) are responsible for the methylation of arginine residues in histones. PRMT5 causes monomethylation and symmetric dimethylation reactions. It works as an oncogene is some neoplasms and is associated with cell proliferation, inhibition of cell death and regulation of tumor suppressor genes. PRMT5 is also involved in stem cell maintenance by controlling differentiation-associated genes. It is involved in cellular responses, including neurogenesis and myogenesis metabolic events, somatic cell reprogramming, regulation of Golgi apparatus, ribosome biogenesis and neuronal spreading and movements.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dongying Chen et al.
Journal of cellular and molecular medicine, 21(4), 781-790 (2016-11-20)
To probe the role of protein arginine methyltransferase 5 (PRMT5) in regulating inflammation, cell proliferation, migration and invasion of fibroblast-like synoviocytes (FLSs) from patients with rheumatoid arthritis (RA). FLSs were separated from synovial tissues (STs) from patients with RA and
Myc and Omomyc functionally associate with the Protein Arginine Methyltransferase 5 (PRMT5) in glioblastoma cells.
Mongiardi MP
Scientific Reports, 5, 15494-15494 (2015)
Nan Wang et al.
Cell death & disease, 11(10), 864-864 (2020-10-17)
Metastasis is the main cause of laryngeal cancer-related death; its molecular mechanism remains unknown. Here we identify protein arginine methyltransferase 5 (PRMT5) as a new metastasis-promoting factor in laryngeal carcinoma, and explore its underlying mechanism of action in regulating laryngeal
Ju-Yeon Jeon et al.
Oncology reports, 40(1), 536-544 (2018-05-12)
Protein arginine methyltransferase 5 (PRMT5) is a protein that catalyzes transfer of methyl groups to the arginine residues of proteins and is involved in diverse cellular and biological responses. While the participation of PRMT5 in cancer progression has been increasingly documented
X Deng et al.
Oncogene, 36(9), 1223-1231 (2016-08-23)
Protein arginine methyltransferase 5 (PRMT5) is an emerging epigenetic enzyme that mainly represses transcription of target genes via symmetric dimethylation of arginine residues on histones H4R3, H3R8 and H2AR3. Accumulating evidence suggests that PRMT5 may function as an oncogene to
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.