Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU062491

Sigma-Aldrich

MISSION® esiRNA

targeting human FYN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTACACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAA

Ensembl | Human Hinterlegungsnummer

ENSG00000010810

NCBI-Hinterlegungsnummer

NM_153048

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... FYN(2534) , FYN(2534)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jing Zheng et al.
Cancer biotherapy & radiopharmaceuticals, 32(9), 320-326 (2017-11-16)
Tyrosine kinase FYN-a member of the SRC family of kinases-is associated with mediating mitogenic signals and regulating cell cycle entry, growth, and proliferation. It was hypothesized that FYN is upregulated in thyroid carcinoma, which plays a critical role in tumorigenesis.
Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.